Candidate division SR1 and gracilibacteria code

The candidate division SR1 and gracilibacteria code (translation table 25) is used in two groups of (so far) uncultivated bacteria found in marine and fresh-water environment and in the intestines and oral cavities of mammals among others. The difference to the standard and the bacterial code is that UGA represents an additional glycine codon and does not code for termination[1]

The code

   AAs = FFLLSSSSYY**CCGWLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG
Starts = ---M-------------------------------M---------------M------------
 Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG
 Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG
 Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)

Differences from the standard code:
This code Standard
UGA Gly STOP *

Initiation codons

Systematic range

See also

References

  1. J. H. Campbell, O'P. Donoghue, A. G. Campbell,, P. Schwientek, A. Sczyrba, T. Woyke, D. Söll and M. Podar (2 April 2013). "UGA is an additional glycine codon in uncultured SR1 bacteria from the human microbiota". Proc Natl Acad Sci U S A 110 (14): 5540–5. doi:10.1073/pnas.1303090110.
  2. The Genetic Codes

External links

This article is issued from Wikipedia - version of the Saturday, March 19, 2016. The text is available under the Creative Commons Attribution/Share Alike but additional terms may apply for the media files.