Yeast mitochondrial code
The yeast mitochondrial code is a genetic code used by the mitochondrial genome of yeasts, notably Saccharomyces cerevisiae, Candida glabrata, Hansenula saturnus, and Kluyveromyces thermotolerans.[1]
The code
AAs = FFLLSSSSYY**CCWWTTTTPPPPHHQQRRRRIIMMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = ---M---------------M---------------M---------------M------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)
| This code | Standard | |
|---|---|---|
| AUA | Met M | Ile I |
| CUU | Thr T | Leu L |
| CUC | Thr T | Leu L |
| CUA | Thr T | Leu L |
| CUG | Thr T | Leu L |
| UGA | Trp W | Ter * |
| CGA | absent | Arg R |
| CGC | absent | Arg R |
- The remaining CGN codons are rare in Saccharomyces cerevisiae and absent in Candida glabrata.
- The AUA codon is common in the gene var1 coding for the single mitochondrial ribosomal protein, but rare in genes encoding the enzymes.
- The coding assignments of the AUA (Met or Ile) and CUU (possibly Leu, not Thr) are uncertain in Hansenula saturnus.
- The coding assignment of Thr to CUN is uncertain in Kluyveromyces thermotolerans.
See also
References
- This article contains public domain text from the NCBI page compiled by Andrzej (Anjay) Elzanowski and Jim Ostell.[2]
- ↑ Clark-Walker, G. D.; Weiller, G. F. (1994). "The structure of the small mitochondrial DNA of Kluyveromyces thermotolerans is likely to reflect the ancestral gene order in fungi". Journal of Molecular Evolution 38 (6): 593–601. doi:10.1007/bf00175879. PMID 8083884.
- ↑ "The Genetic Codes". Retrieved 30 April 2015.
External links
- Susan G. Bonitz, Roberta Berlani, Gloria Coruzzi, May Li, Giuseppe Macino, Francisco G. Nobrega, Marina P. Nobrega, Arbara E. Thalenfeld and Alexander Tzagoloff (June 1980). "Codon recognition rules in yeast mitochondria" (PDF). Proc. Nati. Acad. Sci. USA 77 (6): 3167–3170.
This article is issued from Wikipedia - version of the Saturday, March 19, 2016. The text is available under the Creative Commons Attribution/Share Alike but additional terms may apply for the media files.