Yeast mitochondrial code

The yeast mitochondrial code is a genetic code used by the mitochondrial genome of yeasts, notably Saccharomyces cerevisiae, Candida glabrata, Hansenula saturnus, and Kluyveromyces thermotolerans.[1]

The code

   AAs = FFLLSSSSYY**CCWWTTTTPPPPHHQQRRRRIIMMTTTTNNKKSSRRVVVVAAAADDEEGGGG
Starts = ---M---------------M---------------M---------------M------------
 Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG
 Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG
 Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)

Differences from the standard code:
This code Standard
AUA Met M Ile I
CUU Thr T Leu L
CUC Thr T Leu L
CUA Thr T Leu L
CUG Thr T Leu L
UGA Trp W Ter *
CGA absent Arg R
CGC absent Arg R

See also

References

  1. Clark-Walker, G. D.; Weiller, G. F. (1994). "The structure of the small mitochondrial DNA of Kluyveromyces thermotolerans is likely to reflect the ancestral gene order in fungi". Journal of Molecular Evolution 38 (6): 593–601. doi:10.1007/bf00175879. PMID 8083884.
  2. "The Genetic Codes". Retrieved 30 April 2015.

External links

This article is issued from Wikipedia - version of the Saturday, March 19, 2016. The text is available under the Creative Commons Attribution/Share Alike but additional terms may apply for the media files.