X-linked congenital stationary night blindness

X-linked congenital stationary night blindness
Malfunction in transmission from the photoreceptors in the outer nuclear layer to bipolar cells in the inner nuclear layer underlies CSNB.
Classification and external resources
Specialty	ophthalmology
ICD-10	H53.6
ICD-9-CM	368.61
OMIM	310500 300071
DiseasesDB	32689
MedlinePlus	003039

X-linked congenital stationary night blindness (CSNB) is a rare X-linked non-progressive retinal disorder. It has two forms, complete, also known as type-1 (CSNB1), and incomplete, also known as type-2 (CSNB2), depending on severity. In the complete form (CSNB1), there is no measurable rod cell response to light, whereas this response is measurable in the incomplete form. Patients with this disorder have difficulty adapting to low light situations due to impaired photoreceptor transmission. These patients also often have reduced visual acuity, myopia, nystagmus, and strabismus. CSNB1 is caused by mutations in the gene NYX, which encodes a protein involved in retinal synapse formation or synaptic transmission. CSNB2 is caused by mutations in the gene CACNA1F, which encodes a voltage-gated calcium channel Ca_V1.4.

Not all Congenital Stationary Night Blindness (CSNB) are inherited in X-linked pattern. There are also dominant and recessive inheritance patterns for CSNB.

Symptoms

The X-linked varieties of congenital stationary night blindness (CSNB) can be differentiated from the autosomal forms by the presence of myopia, which is typically absent in the autosomal forms. Patients with CSNB often have impaired night vision, myopia, reduced visual acuity, strabismus, and nystagmus. Individuals with the complete form of CSNB (CSNB1) have highly impaired rod sensitivity (reduced ~300x) as well as cone dysfunction. Patients with the incomplete form can present with either myopia or hyperopia.^[1]

Cause

CSNB was originally believed to be caused by malfunction in neurotransmission from rods to bipolar cells in the retina. This is due to electroretinogram (ERG) measurements on CSNB patients which show a drastic decrease in the size of the scotopic b-wave in comparison to the a-wave, in CSNB2, or a complete loss of both in CSNB1. The a-wave is believed to represent the response of rods to visual input and remains largely unchanged in CSNB2 patients. The b-wave, however, is believed to result from electrical activity of bipolar cells and is decreased or non-existent in both CSNB1 and 2. CSNB1 patients also show mildly altered cone activity. Further study has demonstrated that the defects found in CSNB patients are better explained by more general defects in both the rod and cone ON-signaling pathways.

Pathophysiology

CSNB1

The complete form of X-linked congenital stationary night blindness, also known as nyctalopia, is caused by mutations in the NYX gene (Nyctalopin on X-chromosome), which encodes a small leucine-rich repeat (LRR) family protein of unknown function.^[2][3] This protein consists of an N-terminal signal peptide and 11 LRRs (LRR1-11) flanked by cysteine-rich LRRs (LRRNT and LRRCT). At the C-terminus of the protein there is a putative GPI anchor site. Although the function of NYX is yet to be fully understood, it is believed to be located extracellularly. A naturally occurring deletion of 85 bases in NYX in some mice leads to the "nob" (no b-wave) phenotype, which is highly similar to that seen in CSNB1 patients.^[4] NYX is expressed primarily in the rod and cone cells of the retina. There are currently almost 40 known mutations in NYX associated with CSNB1, Table 1., located throughout the protein. As the function of the nyctalopin protein is unknown, these mutations have not been further characterized. However, many of them are predicted to lead to truncated proteins that, presumably, are non-functional.

Table 1. Mutations in NYX associated with CSNB1

Mutation		Position	References
Nucleotide	Amino acid
c.?-1_?-61del	1_20del	Signal sequence	[3]
Splicing	Intron 1		[5]
c.?-63_1443-?del	21_481del		[3]
c.48_64del	L18RfsX108	Signal sequence	[5]
c.85_108del	R29_A36del	N-terminal LRR	[2]
c.G91C	C31S	LRRNT	[3]
c.C105A	C35X	LRRNT	[3]
c.C169A	P57T	LRRNT	[6]
c.C191A	A64E	LRR1	[6]
c.G281C	R94P	LRR2	[7]
c.301_303del	I101del	LRR2	[3]
c.T302C	I101T	LRR2	[7]
c.340_351del	E114_A118del	LRR3	[3][5]
c.G427C	A143P	LRR4	[3]
c.C452T	P151L	LRR4	[2]
c.464_465insAGCGTGCCCGAGCGCCTCCTG	S149_V150dup+P151_L155dup	LRR4	[2]
c.C524G	P175R	LRR5	[3]
c.T551C	L184P	LRR6	[2]
c.556_618delins	H186?fsX260	LRR6	[2]
c.559_560delinsAA	A187K	LRR6	[3]
c.613_621dup	205_207dup	LRR7	[2][3]
c.628_629ins	R209_S210insCLR	LRR7	[2]
c.T638A	L213Q	LRR7	[2]
c.A647G	N216S	LRR7	[2][5]
c.T695C	L232P	LRR8	[2]
c.727_738del	243_246del	LRR8	[3]
c.C792G	N264K	LRR9	[2]
c.T854C	L285P	LRR10	[2]
c.T893C	F298S	LRR10	[2]
c.C895T	Q299X	LRR10	[5]
c.T920C	L307P	LRR11	[3]
c.A935G	N312S	LRR11	[3]
c.T1040C	L347P	LRRCT	[3]
c.G1049A	W350X	LRRCT	[2]
c.G1109T	G370V	LRRCT	[3]
c.1122_1457del	S374RfsX383	LRRCT	[3][5]
c.1306del	L437WfsX559	C-terminus	[5]
LRR: leucine-rich repeat, LRRNT and LRRCT: N- and C-terminal cysteine-rich LRRs.

CSNB2

Figure 1. Schematic structure of Ca_V1.4 with the domains and subunits labeled.

The incomplete form of X-linked congenital stationary night blindness (CSNB2) is caused by mutations in the CACNA1F gene, which encodes the voltage-gated calcium channel Ca_V1.4 expressed heavily in retina.^[8][9] One of the important properties of this channel is that it inactivates at an extremely low rate. This allows it to produce sustained Ca²⁺ entry upon depolarization. As photoreceptors depolarize in the absence of light, Ca_V1.4 channels operate to provide sustained neurotransmitter release upon depolarization.^[10] This has been demonstrated in CACNA1F mutant mice that have markedly reduced photoreceptor calcium signals.^[11] There are currently 55 mutations in CACNA1F located throughout the channel, Table 2 and Figure 1. While most of these mutations result in truncated and, likely, non-functional channels, it is expected that they prevent the ability of light to hyperpolarize photoreceptors. Of the mutations with known functional consequences, 4 produce channels that are either completely non-functional, and two that result in channels which open at far more hyperpolarized potentials than wild-type. This will result in photoreceptors that continue to release neurotransmitter even after light-induced hyperpolarization.

Table 2. Mutations in CACNA1F associated with CSNB2

Mutation		Position	Effect	References
Nucleotide	Amino Acid
c.C148T	R50X	N-terminus		[12]
c.151_155delAGAAA	R51PfsX115	N-terminus		[13]
c.T220C	C74R	N-terminus		[13]
c.C244T	R82X	N-terminus		[12][13]
c.466_469delinsGTAGGGGTGCT CCACCCCGTAGGGGTGCTCCACC	S156VdelPinsGVKHOVGVLH	D1S2-3		[12][14][15]
	Splicing	Intron 4		[12]
c.T685C	S229P	D1S4-5		[13]
c.G781A	G261R	D1-pore		[13]
c.G832T	E278X	D1-pore		[5][16]
c.904insG	R302AfsX314	D1-pore		[14]
c.951_953delCTT	F318del	D1-pore		[12]
c.G1106A	G369D	D1S6	Activates ~20mV more negative than wild-type, increases time to peak current and decreases inactivation, increased Ca^2+ permeability.	[8][10][12][13][17]
c.1218delC	W407GfsX443	D1-2		[9][12][16]
c.C1315T	Q439X	D1-2		[13]
c.G1556A	R519Q	D1-2	Decreased expression	[8][18]
c.C1873T	R625X	D2S4		[12][13]
c.G2021A	G674D	D2S5		[10][12][14]
c.C2071T	R691X	D2-pore		[6]
c.T2258G	F753C	D2S6		[13]
c.T2267C	I756T	D2S6	Activates ~35mV more negative than wild-type, inactivates more slowly	[19]
	Splicing	Intron 19		[13]
c.T2579C	L860P	D2-3		[13]
c.C2683T	R895X	D3S1-2		[5][6][9][12]
	Splicing	Intron 22		[13][14]
	Splicing	Intron 22		[13]
c.C2783A	A928D	D3S2-3		[10][12]
c.C2905T	R969X	D3S4		[8][13]
c.C2914T	R972X	D3S4		[16]
	Splicing	Intron24		[12]
c.C2932T	R978X	D3S4		[14]
c.3006_3008delCAT	I1003del	D3S4-5		[12]
c.G3052A	G1018R	D3S5		[13]
c.3125delG	G1042AfsX1076	D3-pore		[12]
c.3166insC	L1056PfsX1066	D3-pore		[8][9][12][13]
c.C3178T	R1060W	D3-pore		[8][13]
c.T3236C	L1079P	D3-pore	Does not open without BayK, activates ~5mV more negative than wild-type	[13][17]
c.3672delC	L1225SfsX1266	D4S2		[9][12]
c.3691_3702del	G1231_T1234del	D4S2		[8][13]
c.G3794T	S1265I	D4S3		[6]
c.C3886A	R1296S	D4S4		[6]
c.C3895T	R1299X	D4S4		[9][12][13]
	Splicing	Intron 32		[13]
c.C4075T	Q1359X	D4-pore		[8][13]
c.T4124A	L1375H	D4-pore	Decreased expression	[8][13][18]
	Splicing	Intron 35		[13]
c.G4353A	W1451X	C-terminus	Non-functional	[9][10][12][17]
c.T4495C	C1499R	C-terminus		[13]
c.C4499G	P1500R	C-terminus		[13]
c.T4523C	L1508P	C-terminus		[13]
	Splicing	intron 40		[12]
c.4581delC	F1528LfsX1535	C-terminus		[20]
c.A4804T	K1602X	C-terminus		[8][13]
c.C5479T	R1827X	C-terminus		[13]
c.5663delG	S1888TfsX1931	C-terminus		[12]
c.G5789A	R1930H	C-terminus		[6]

Genetics

Only three rhodopsin mutations have been found associated with congenital stationary night blindness (CSNB).^[21] Two of these mutations are found in the second transmembrane helix of rhodopsin at Gly-90 and Thr-94. Specifically, these mutations are the Gly90Asp ^[22] and the Thr94Ile, which has been the most recent one reported.^[23] The third mutation is Ala292Glu, and it is located in the seventh transmembrane helix, in proximity to the site of retinal attachment at Lys-296.^[24] Mutations associated with CSNB affect amino acid residues near the protonated Schiff base (PSB) linkage. They are associated with changes in conformational stability and the protonated status of the PSB nitrogen.^[25]

Footnotes

1. Boycott K, Pearce W, Musarella M, Weleber R, Maybaum T, Birch D, Miyake Y, Young R, Bech-Hansen N (1998). "Evidence for genetic heterogeneity in X-linked congenital stationary night blindness". Am J Hum Genet 62 (4): 865–875. doi:10.1086/301781. PMC 1377021. PMID 9529339.
2. Bech-Hansen N, Naylor M, Maybaum T, Sparkes R, Koop B, Birch D, Bergen A, Prinsen C, Polomeno R, Gal A, Drack A, Musarella M, Jacobson S, Young R, Weleber R (2000). "Mutations in NYX, encoding the leucine-rich proteoglycan nyctalopin, cause X-linked complete congenital stationary night blindness". Nat Genet 26 (3): 319–323. doi:10.1038/81619. PMID 11062471.
3. Pusch C, Zeitz C, Brandau O, Pesch K, Achatz H, Feil S, Scharfe C, Maurer J, Jacobi F, Pinckers A, Andreasson S, Hardcastle A, Wissinger B, Berger W, Meindl A (2000). "The complete form of X-linked congenital stationary night blindness is caused by mutations in a gene encoding a leucine-rich repeat protein". Nat Genet 26 (3): 324–327. doi:10.1038/81627. PMID 11062472.
4. Gregg R, Mukhopadhyay S, Candille S, Ball S, Pardue M, McCall M, Peachey N (2003). "Identification of the gene and the mutation responsible for the mouse nob phenotype". Invest Ophthalmol Vis Sci 44 (1): 378–384. doi:10.1167/iovs.02-0501. PMID 12506099.
5. Zito I, Allen L, Patel R, Meindl A, Bradshaw K, Yates J, Bird A, Erskine L, Cheetham M, Webster A, Poopalasundaram S, Moore A, Trump D, Hardcastle A (2003). "Mutations in the CACNA1F and NYX genes in British CSNBX families". Hum Mutat 21 (2): 169–169. doi:10.1002/humu.9106. PMID 12552565.
6. Zeitz C, Minotti R, Feil S, Mátyás G, Cremers F, Hoyng C, Berger W (2005). "Novel mutations in CACNA1F and NYX in Dutch families with X-linked congenital stationary night blindness". Mol Vis 11: 179–83. PMID 15761389.
7. Xiao X, Jia X, Guo X, Li S, Yang Z, Zhang Q (2006). "CSNB1 in Chinese families associated with novel mutations in NYX". J Hum Genet 51 (7): 634–640. doi:10.1007/s10038-006-0406-5. PMID 16670814.
8. Strom T, Nyakatura G, Apfelstedt-Sylla E, Hellebrand H, Lorenz B, Weber B, Wutz K, Gutwillinger N, Rüther K, Drescher B, Sauer C, Zrenner E, Meitinger T, Rosenthal A, Meindl A (1998). "An L-type calcium-channel gene mutated in incomplete X-linked congenital stationary night blindness". Nat Genet 19 (3): 260–263. doi:10.1038/940. PMID 9662399.
9. Bech-Hansen N, Naylor M, Maybaum T, Pearce W, Koop B, Fishman G, Mets M, Musarella M, Boycott K (1998). "Loss-of-function mutations in a calcium-channel alpha1-subunit gene in Xp11.23 cause incomplete X-linked congenital stationary night blindness". Nat Genet 19 (3): 264–267. doi:10.1038/947. PMID 9662400.
10. McRory J, Hamid J, Doering C, Garcia E, Parker R, Hamming K, Chen L, Hildebrand M, Beedle A, Feldcamp L, Zamponi G, Snutch T (2004). "The CACNA1F gene encodes an L-type calcium channel with unique biophysical properties and tissue distribution". J Neurosci 24 (7): 1707–1718. doi:10.1523/JNEUROSCI.4846-03.2004. PMID 14973233.
11. Mansergh F, Orton N, Vessey J, Lalonde M, Stell W, Tremblay F, Barnes S, Rancourt D, Bech-Hansen N (2005). "Mutation of the calcium channel gene Cacna1f disrupts calcium signaling, synaptic transmission and cellular organization in mouse retina". Hum Mol Genet 14 (20): 3035–3046. doi:10.1093/hmg/ddi336. PMID 16155113.
12. Boycott K, Maybaum T, Naylor M, Weleber R, Robitaille J, Miyake Y, Bergen A, Pierpont M, Pearce W, Bech-Hansen N (2001). "A summary of 20 CACNA1F mutations identified in 36 families with incomplete X-linked congenital stationary night blindness, and characterization of splice variants". Hum Genet 108 (2): 91–97. doi:10.1007/s004390100461. PMID 11281458.
13. Wutz K, Sauer C, Zrenner E, Lorenz B, Alitalo T, Broghammer M, Hergersberg M, de la Chapelle A, Weber B, Wissinger B, Meindl A, Pusch C (2002). "Thirty distinct CACNA1F mutations in 33 families with incomplete type of XLCSNB and Cacna1f expression profiling in mouse retina". Eur J Hum Genet 10 (8): 449–456. doi:10.1038/sj.ejhg.5200828. PMID 12111638.
14. Nakamura M, Ito S, Terasaki H, Miyake Y (2001). "Novel CACNA1F mutations in Japanese patients with incomplete congenital stationary night blindness". Invest Ophthalmol Vis Sci 42 (7): 1610–6. PMID 11381068.
15. Nakamura M, Ito S, Piao C, Terasaki H, Miyake Y (2003). "Retinal and optic disc atrophy associated with a CACNA1F mutation in a Japanese family". Arch Ophthalmol 121 (7): 1028–1033. doi:10.1001/archopht.121.7.1028. PMID 12860808.
16. Allen L, Zito I, Bradshaw K, Patel R, Bird A, Fitzke F, Yates J, Trump D, Hardcastle A, Moore A (2003). "Genotype-phenotype correlation in British families with X linked congenital stationary night blindness". Br J Ophthalmol 87 (11): 1413–1420. doi:10.1136/bjo.87.11.1413. PMC 1771890. PMID 14609846.
17. Hoda J, Zaghetto F, Koschak A, Striessnig J (2005). "Congenital stationary night blindness type 2 mutations S229P, G369D, L1068P, and W1440X alter channel gating or functional expression of Ca(v)1.4 L-type Ca2+ channels". J Neurosci 25 (1): 252–259. doi:10.1523/JNEUROSCI.3054-04.2005. PMID 15634789.
18. Hoda J, Zaghetto F, Singh A, Koschak A, Striessnig J (2006). "Effects of congenital stationary night blindness type 2 mutations R508Q and L1364H on Cav1.4 L-type Ca2+ channel function and expression". J Neurochem 96 (6): 1648–1658. doi:10.1111/j.1471-4159.2006.03678.x. PMID 16476079.
19. Hemara-Wahanui A, Berjukow S, Hope C, Dearden P, Wu S, Wilson-Wheeler J, Sharp D, Lundon-Treweek P, Clover G, Hoda J, Striessnig J, Marksteiner R, Hering S, Maw M (2005). "A CACNA1F mutation identified in an X-linked retinal disorder shifts the voltage dependence of Cav1.4 channel activation". Proc Natl Acad Sci USA 102 (21): 7553–7558. doi:10.1073/pnas.0501907102. PMC 1140436. PMID 15897456.
20. Jacobi F, Hamel C, Arnaud B, Blin N, Broghammer M, Jacobi P, Apfelstedt-Sylla E, Pusch C (2003). "A novel CACNA1F mutation in a french family with the incomplete type of X-linked congenital stationary night blindness". Am J Ophthalmol 135 (5): 733–736. doi:10.1016/S0002-9394(02)02109-8. PMID 12719097.
21. Pere Garriga, and Joan Manyosa. The eye photoreceptor protein rhodopsin. Structural implications for retinal disease. Volume 528, Issues 1–3, 25 September 2002, Pages 17–22.
22. V.R. Rao, G.B. Cohen and D.D. Oprian Nature 367 (1994), pp. 639–642.
23. N. al-Jandal, G.J. Farrar, A.S. Kiang, M.M. Humphries, N. Bannon, J.B. Findlay, P. Humphries and P.F. Kenna Hum. Mutat. 13 (1999), pp. 75–81.
24. T.P. Dryja, E.L. Berson, V.R. Rao and D.D. Oprian Nat. Genet. 4 (1993), pp. 280–283.
25. P.A. Sieving, J.E. Richards, F. Naarendorp, E.L. Bingham, K. Scott and M. Alpern Proc. Natl. Acad. Sci. USA 92 (1995), pp. 880–884.

External links

• GeneReview/NCBI/NIH/UW entry on X-Linked Congenital Stationary Night Blindness